ID: 1189613818_1189613828

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1189613818 1189613828
Species Human (GRCh38) Human (GRCh38)
Location X:42764746-42764768 X:42764796-42764818
Sequence CCTCTGCTGTCCAAAAGTCAGTT GGAAACTCCCTCACCTCTCTGGG
Strand - +
Off-target summary {0: 6, 1: 3, 2: 2, 3: 14, 4: 181} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!