ID: 1189628041_1189628048

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1189628041 1189628048
Species Human (GRCh38) Human (GRCh38)
Location X:42920688-42920710 X:42920717-42920739
Sequence CCCTGGCAGTAGCTGTGTGGCAT AAAATCTGTGTACTGGGGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 15, 3: 86, 4: 448}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!