ID: 1189710467_1189710471

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1189710467 1189710471
Species Human (GRCh38) Human (GRCh38)
Location X:43806325-43806347 X:43806353-43806375
Sequence CCTTATTTTTCATAACCTTCAAA AAGAATACGGGTCAGTTATCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 72, 4: 783} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!