ID: 1189726740_1189726743

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1189726740 1189726743
Species Human (GRCh38) Human (GRCh38)
Location X:43975088-43975110 X:43975104-43975126
Sequence CCGTCCACCTTCTCATTTCTCCC TTCTCCCAAGAAATAATCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 98, 4: 936} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!