ID: 1189794426_1189794437

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1189794426 1189794437
Species Human (GRCh38) Human (GRCh38)
Location X:44633813-44633835 X:44633847-44633869
Sequence CCACCCACTGGGTGTGAACTCGG ATGGCGGCTGGTTTTCTTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 6, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!