ID: 1189849226_1189849230

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1189849226 1189849230
Species Human (GRCh38) Human (GRCh38)
Location X:45162474-45162496 X:45162500-45162522
Sequence CCCACTTACAGAGTGAGACCTTT TACTTCTGTTTGGCATGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 373} {0: 1, 1: 0, 2: 1, 3: 10, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!