ID: 1189849227_1189849228

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1189849227 1189849228
Species Human (GRCh38) Human (GRCh38)
Location X:45162475-45162497 X:45162490-45162512
Sequence CCACTTACAGAGTGAGACCTTTG GACCTTTGTCTACTTCTGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 218} {0: 1, 1: 0, 2: 3, 3: 17, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!