ID: 1189863856_1189863863

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1189863856 1189863863
Species Human (GRCh38) Human (GRCh38)
Location X:45302354-45302376 X:45302398-45302420
Sequence CCAAACTCCTTTTTGGGAGAAAC CCCAAGAGTGTAAACAGACAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 202} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!