ID: 1189871942_1189871952

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1189871942 1189871952
Species Human (GRCh38) Human (GRCh38)
Location X:45393492-45393514 X:45393538-45393560
Sequence CCAGAGCACACTGGTGCAAAAGT TCTTCCTCTGTGGCTTTGCAGGG
Strand - +
Off-target summary No data {0: 7, 1: 148, 2: 853, 3: 1653, 4: 2009}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!