ID: 1189872160_1189872161

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1189872160 1189872161
Species Human (GRCh38) Human (GRCh38)
Location X:45395207-45395229 X:45395227-45395249
Sequence CCTGCAGTGTTTCTGCTGAGAAA AAATATGCTGATAGTCATATTGG
Strand - +
Off-target summary {0: 1, 1: 18, 2: 133, 3: 462, 4: 1089} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!