ID: 1189912450_1189912463

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1189912450 1189912463
Species Human (GRCh38) Human (GRCh38)
Location X:45824727-45824749 X:45824766-45824788
Sequence CCATGAAGGGCTCACAGCCCACC GGGAAGGAAGAGCCTAAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 220} {0: 1, 1: 0, 2: 2, 3: 38, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!