ID: 1189942420_1189942432

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1189942420 1189942432
Species Human (GRCh38) Human (GRCh38)
Location X:46138480-46138502 X:46138531-46138553
Sequence CCTGCCTCCTTGACCTTGTCCTG GGGGCATTACCCTGGCCACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 381} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!