ID: 1189951056_1189951059

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1189951056 1189951059
Species Human (GRCh38) Human (GRCh38)
Location X:46231243-46231265 X:46231259-46231281
Sequence CCTGGGACCCTAACTGATACACA ATACACACATTATTCAATGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 117} {0: 1, 1: 0, 2: 1, 3: 22, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!