ID: 1189985408_1189985414

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1189985408 1189985414
Species Human (GRCh38) Human (GRCh38)
Location X:46549165-46549187 X:46549214-46549236
Sequence CCAGGTTCCTTTTTCCCTCTGTG TTTCTTTTCTGAAATGAAAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!