ID: 1190059437_1190059446

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1190059437 1190059446
Species Human (GRCh38) Human (GRCh38)
Location X:47201421-47201443 X:47201471-47201493
Sequence CCTGTCTGCTCTTGGTACCCTGG TAACCAGGACAACCCCGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 340} {0: 1, 1: 0, 2: 0, 3: 0, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!