ID: 1190063266_1190063269

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1190063266 1190063269
Species Human (GRCh38) Human (GRCh38)
Location X:47224114-47224136 X:47224129-47224151
Sequence CCACCTAGCTGCCGGCTCTGAGC CTCTGAGCTCAGCTTGCCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 6, 3: 47, 4: 463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!