ID: 1190063744_1190063749

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1190063744 1190063749
Species Human (GRCh38) Human (GRCh38)
Location X:47226622-47226644 X:47226649-47226671
Sequence CCAATGAGGTGGTGACACTGTGG GGCCCCCTGACATCCTGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 143} {0: 1, 1: 0, 2: 0, 3: 16, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!