ID: 1190066549_1190066553

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1190066549 1190066553
Species Human (GRCh38) Human (GRCh38)
Location X:47245328-47245350 X:47245349-47245371
Sequence CCTCACAGCCGGCCATCTGGTTG TGTCTGTTCACCCAATCCTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 110} {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!