ID: 1190116225_1190116236

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1190116225 1190116236
Species Human (GRCh38) Human (GRCh38)
Location X:47627628-47627650 X:47627657-47627679
Sequence CCAGCCGCCCATCTCTGTGGGAG GAGGGTAATGGGATGGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 200} {0: 1, 1: 0, 2: 4, 3: 54, 4: 569}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!