ID: 1190181182_1190181190

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1190181182 1190181190
Species Human (GRCh38) Human (GRCh38)
Location X:48194166-48194188 X:48194189-48194211
Sequence CCCCTGGAAGTCTGCGACCCGTT TATTACGCATGAAAGGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 9, 4: 37} {0: 1, 1: 11, 2: 2, 3: 4, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!