ID: 1190200206_1190200214

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1190200206 1190200214
Species Human (GRCh38) Human (GRCh38)
Location X:48354894-48354916 X:48354919-48354941
Sequence CCTTCCTAGCTTCACCCCTGCCA CTGTCGGGCTTTAATGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 346} {0: 1, 1: 0, 2: 7, 3: 3, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!