ID: 1190213460_1190213471

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1190213460 1190213471
Species Human (GRCh38) Human (GRCh38)
Location X:48466014-48466036 X:48466058-48466080
Sequence CCCCTCGGGGTCCATGTACAGGA GCTCAGATTTGATGATGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55} {0: 1, 1: 0, 2: 1, 3: 9, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!