ID: 1190223318_1190223325

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1190223318 1190223325
Species Human (GRCh38) Human (GRCh38)
Location X:48527251-48527273 X:48527275-48527297
Sequence CCTCCGCTTCATTCTACAGCTTG GGTCTCTGTGGGTAAGGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103} {0: 1, 1: 0, 2: 2, 3: 28, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!