ID: 1190246892_1190246899

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1190246892 1190246899
Species Human (GRCh38) Human (GRCh38)
Location X:48696773-48696795 X:48696816-48696838
Sequence CCGTGGGGAAAGATGGCGGAAAA AGGCAGAGGCGCGGGCCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 367} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!