ID: 1190265921_1190265932

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1190265921 1190265932
Species Human (GRCh38) Human (GRCh38)
Location X:48827100-48827122 X:48827139-48827161
Sequence CCAGGGCCGCGGCCTCCCTGCGC GAGTGTGGCCCCGTCCCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 432} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!