ID: 1190268650_1190268663

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1190268650 1190268663
Species Human (GRCh38) Human (GRCh38)
Location X:48845379-48845401 X:48845429-48845451
Sequence CCACACCACTTCACTCCAGCCGG CCTGGGGACCCTGTTTCCCTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 32, 4: 521}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!