ID: 1190275757_1190275767

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1190275757 1190275767
Species Human (GRCh38) Human (GRCh38)
Location X:48898141-48898163 X:48898167-48898189
Sequence CCATCCCAGCGCTTTGGTTTCTC CCCGGCAGTCATGGGGACGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 204} {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!