ID: 1190285289_1190285299

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1190285289 1190285299
Species Human (GRCh38) Human (GRCh38)
Location X:48957434-48957456 X:48957461-48957483
Sequence CCCACGCCCGTGCCGCCGCCGCC CCCACACCTCCGCCGCGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 28, 3: 210, 4: 2031} {0: 1, 1: 0, 2: 2, 3: 13, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!