ID: 1190285293_1190285308

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1190285293 1190285308
Species Human (GRCh38) Human (GRCh38)
Location X:48957446-48957468 X:48957476-48957498
Sequence CCGCCGCCGCCCACGCCCACACC CGCCGCGGCGCCGGGGGCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 141, 4: 1692} {0: 1, 1: 0, 2: 1, 3: 18, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!