ID: 1190285298_1190285315

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1190285298 1190285315
Species Human (GRCh38) Human (GRCh38)
Location X:48957461-48957483 X:48957491-48957513
Sequence CCCACACCTCCGCCGCGCCGCGG GGCATCGGCCCGGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 209} {0: 1, 1: 0, 2: 4, 3: 65, 4: 821}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!