ID: 1190285305_1190285323

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1190285305 1190285323
Species Human (GRCh38) Human (GRCh38)
Location X:48957470-48957492 X:48957514-48957536
Sequence CCGCCGCGCCGCGGCGCCGGGGG CTCGTTGGCGGGGTCGGCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 395} {0: 1, 1: 0, 2: 2, 3: 4, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!