ID: 1190302205_1190302222

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1190302205 1190302222
Species Human (GRCh38) Human (GRCh38)
Location X:49063658-49063680 X:49063708-49063730
Sequence CCCACCACCCCAGGGGTTTGGGC TGGAGATACTGGTAGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 189} {0: 1, 1: 0, 2: 3, 3: 41, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!