ID: 1190303391_1190303395

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1190303391 1190303395
Species Human (GRCh38) Human (GRCh38)
Location X:49068914-49068936 X:49068953-49068975
Sequence CCTTCCTCCATTTATGTTTACAG CACTGTCTTCCTCCAACACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 257} {0: 1, 1: 0, 2: 3, 3: 27, 4: 403}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!