ID: 1190314683_1190314689

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1190314683 1190314689
Species Human (GRCh38) Human (GRCh38)
Location X:49142875-49142897 X:49142927-49142949
Sequence CCAGAGTATGTACACACTAGAAC GCATCTTGGTGAAGTCTACTTGG
Strand - +
Off-target summary No data {0: 5, 1: 8, 2: 8, 3: 29, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!