ID: 1190318779_1190318783

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1190318779 1190318783
Species Human (GRCh38) Human (GRCh38)
Location X:49167164-49167186 X:49167183-49167205
Sequence CCCTGGACGGGCCGGGCTAAAAA AAAAAGGCTGTTAGAACCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 27} {0: 1, 1: 0, 2: 0, 3: 11, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!