ID: 1190320371_1190320384

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1190320371 1190320384
Species Human (GRCh38) Human (GRCh38)
Location X:49176344-49176366 X:49176373-49176395
Sequence CCTTCTTTCCTCCACTAAGACTG TGGGGGCAGGGGTCGGAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 254} {0: 1, 1: 1, 2: 8, 3: 121, 4: 1164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!