ID: 1190320770_1190320778

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1190320770 1190320778
Species Human (GRCh38) Human (GRCh38)
Location X:49178010-49178032 X:49178037-49178059
Sequence CCATCACAGTACTCCGCGTGGCG TCGTAGCAGGCGCAGCAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 17} {0: 1, 1: 0, 2: 1, 3: 1, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!