ID: 1190326366_1190326369

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1190326366 1190326369
Species Human (GRCh38) Human (GRCh38)
Location X:49209455-49209477 X:49209478-49209500
Sequence CCTGCAGGCGGGTAGGGTGGGGG AAGGAGTCCTTCAGCCACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 384} {0: 1, 1: 0, 2: 1, 3: 21, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!