ID: 1190335260_1190335274

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1190335260 1190335274
Species Human (GRCh38) Human (GRCh38)
Location X:49258201-49258223 X:49258232-49258254
Sequence CCAGCCCCCCTCCCGCCCAGTGC AGGTCGGCACCTGTAGGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 103, 4: 924} {0: 1, 1: 0, 2: 2, 3: 11, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!