ID: 1190335261_1190335274

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1190335261 1190335274
Species Human (GRCh38) Human (GRCh38)
Location X:49258205-49258227 X:49258232-49258254
Sequence CCCCCCTCCCGCCCAGTGCCACA AGGTCGGCACCTGTAGGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 457} {0: 1, 1: 0, 2: 2, 3: 11, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!