ID: 1190364632_1190364636

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1190364632 1190364636
Species Human (GRCh38) Human (GRCh38)
Location X:49680082-49680104 X:49680108-49680130
Sequence CCACTTTCAATCACATGCAAATT GGGTCAGTCAATGCAAATTGAGG
Strand - +
Off-target summary {0: 3, 1: 29, 2: 108, 3: 256, 4: 526} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!