ID: 1190408344_1190408350

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1190408344 1190408350
Species Human (GRCh38) Human (GRCh38)
Location X:50110125-50110147 X:50110152-50110174
Sequence CCTCAAAAATTTGGAGGCTACGG TCAAAGGCAGTTTGGAGGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 15, 3: 93, 4: 394}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!