ID: 1190429705_1190429712

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1190429705 1190429712
Species Human (GRCh38) Human (GRCh38)
Location X:50367474-50367496 X:50367507-50367529
Sequence CCAGGCCCATGTTTTTTCTGATC CCCTCTGTACTCAAGGGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 323} {0: 1, 1: 0, 2: 0, 3: 19, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!