ID: 1190436652_1190436656

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1190436652 1190436656
Species Human (GRCh38) Human (GRCh38)
Location X:50432174-50432196 X:50432224-50432246
Sequence CCAGATCTTTCTACCACGCAGGT TCCCACTGCTTCCTGTGCTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 30, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!