ID: 1190527878_1190527882

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1190527878 1190527882
Species Human (GRCh38) Human (GRCh38)
Location X:51346241-51346263 X:51346279-51346301
Sequence CCGGTAGCAGGCCAAGAGCTATT AGTTATATGCAGAGCATGGCAGG
Strand - +
Off-target summary {0: 3, 1: 12, 2: 50, 3: 260, 4: 350} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!