ID: 1190554766_1190554768

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1190554766 1190554768
Species Human (GRCh38) Human (GRCh38)
Location X:51623068-51623090 X:51623082-51623104
Sequence CCTGCAAATTAAGGGGCAGGTCA GGCAGGTCAATGCAAATTGAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 9, 4: 110} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!