ID: 1190556052_1190556063

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1190556052 1190556063
Species Human (GRCh38) Human (GRCh38)
Location X:51636988-51637010 X:51637031-51637053
Sequence CCTGTCTCTTATCATTCCTTTGT CCTACTGGTGGTGTTGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 23, 2: 17, 3: 43, 4: 389} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!