ID: 1190598805_1190598817

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1190598805 1190598817
Species Human (GRCh38) Human (GRCh38)
Location X:52069300-52069322 X:52069336-52069358
Sequence CCAACAAAAGCCCTTTCCTCCAG ATGCGATTCCGCGGGTGGGTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 5, 3: 25, 4: 334} {0: 2, 1: 0, 2: 0, 3: 1, 4: 23}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!