|
Left Crispr |
Right Crispr |
Crispr ID |
1190604977 |
1190604980 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
X:52131793-52131815
|
X:52131826-52131848
|
Sequence |
CCCATTCACAATAGCCATAAAAA |
CATAGAAATACAGCTAGCCATGG |
Strand |
- |
+ |
Off-target summary |
{0: 9, 1: 174, 2: 848, 3: 2038, 4: 5943} |
{0: 1, 1: 3, 2: 108, 3: 782, 4: 2214} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|