ID: 1190610165_1190610175

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1190610165 1190610175
Species Human (GRCh38) Human (GRCh38)
Location X:52185364-52185386 X:52185398-52185420
Sequence CCTCTAGTGCTCGAGTCTGAGCC CCCCGCCCGGACCTAGCCAAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 2, 4: 59} {0: 2, 1: 0, 2: 2, 3: 6, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!